01MiRNAome of stem lettuce contains 82 miRNA loci (MIRs) belonging to 41 families, 1 cluster
and 2,831 predicted miRNA-target pairs. In addition, 16 deeply sequenced small RNA libraries belong to 3
tissues (leaf, root, stem) were used in quantification of miRNA expression patterns, and 3 PARE-Seq
libraries were employed to validate predicted miRNA-target pairs.target pairs.
In
addition, 16 deeply sequenced small RNA libraries belong to 3 tissues (leaf, root, stem) were used in
quantification of miRNA
02MiRNAome of stem lettuce contains 82 miRNA loci (MIRs) belonging to 41 families, 1 cluster
and 2,831 predicted miRNA-target pairs. In addition, 16 deeply sequenced small RNA libraries belong to 3
tissues (leaf, root, stem) were used in quantification of miRNA expression patterns, and 3 PARE-Seq
libraries were employed to validate predicted miRNA-target pairs.target pairs.
In
addition, 16 deeply sequenced small RNA libraries belong to 3 tissues (leaf, root, stem) were used in
quantification of miRNA
03MiRNAome of stem lettuce contains 82 miRNA loci (MIRs) belonging to 41 families, 1 cluster
and 2,831 predicted miRNA-target pairs. In addition, 16 deeply sequenced small RNA libraries belong to 3
tissues (leaf, root, stem) were used in quantification of miRNA expression patterns, and 3 PARE-Seq
libraries were employed to validate predicted miRNA-target pairs.target pairs.
In
addition, 16 deeply sequenced small RNA libraries belong to 3 tissues (leaf, root, stem) were used in
quantification of miRNA
04MiRNAome of stem lettuce contains 82 miRNA loci (MIRs) belonging to 41 families, 1 cluster
and 2,831 predicted miRNA-target pairs. In addition, 16 deeply sequenced small RNA libraries belong to 3
tissues (leaf, root, stem) were used in quantification of miRNA expression patterns, and 3 PARE-Seq
libraries were employed to validate predicted miRNA-target pairs.target pairs.
In
addition, 16 deeply sequenced small RNA libraries belong to 3 tissues (leaf, root, stem) were used in
quantification of miRNA
05MiRNAome of stem lettuce contains 82 miRNA loci (MIRs) belonging to 41 families, 1 cluster
and 2,831 predicted miRNA-target pairs. In addition, 16 deeply sequenced small RNA libraries belong to 3
tissues (leaf, root, stem) were used in quantification of miRNA expression patterns, and 3 PARE-Seq
libraries were employed to validate predicted miRNA-target pairs.target pairs.
In
addition, 16 deeply sequenced small RNA libraries belong to 3 tissues (leaf, root, stem) were used in
quantification of miRNA
| Description: | Overexpression Lsa-MIR408 in Lactuca sativa |
|---|---|
| Donation Data: | 28 October 2021 |
| Donated by: | Qin Yajuan, Yang Pan |
| Material type: | Seed |
| Species: | Lactuca sativa |
|---|---|
| Category: | Overexpression |
| Background: | Losseleaf |
| Name: | 35S:Lsa-MIR408-6 |
| Gene: | MIR408 |
| Position: | Lsat_1_v8_lg_1 + 141416633-141416653 |
| Sequence: | TGCACTGCCTCTTCCCTGGCT |
| Growth requirement: | Achenes were first sown on a wet filter paper in a petri dish and moved directly to the soil in plastic pots after germination. The seedlings were cultured in a greenhouse (16 h/8 h day/night cycle, light intensity 200 μmol m-2 s-1, relative humidity 30–5 |
| Image: | 408-6_1.png ; 408-6_2.png ; 408-6_3.png ; |
Germplasm